vps33b

Ensembl ID:
ENSDARG00000044813
ZFIN ID:
ZDB-GENE-050327-73
Description:
Vacuolar protein sorting-associated protein 33B [Source:UniProtKB/Swiss-Prot;Acc:Q58EN8]
Human Orthologue:
VPS33B
Human Description:
vacuolar protein sorting 33 homolog B (yeast) [Source:HGNC Symbol;Acc:12712]
Mouse Orthologue:
Vps33b
Mouse Description:
vacuolar protein sorting 33B (yeast) Gene [Source:MGI Symbol;Acc:MGI:2446237]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34177 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31593 Nonsense Available for shipment Available now
sa9761 Essential Splice Site Available for shipment Available now
sa12663 Essential Splice Site Available for shipment Available now
sa27045 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065868 Essential Splice Site 59 617 3 24
Genomic Location (Zv9):
Chromosome 7 (position 51851769)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50122005
GRCz11 7 50394781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTTGATGAGTCCTCTAGATCGAATTGCAAATGTCACAATCCTAAAGG[T/A]GTGTTATCTTATACAACAAGGTTTGGGAAATGATTTGCAGTTTATATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065868 Nonsense 155 617 8 24
Genomic Location (Zv9):
Chromosome 7 (position 51850025)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50120261
GRCz11 7 50393037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGAATGGAATTTCTACATTCTTCCTCTGGATGACGATATCCTCAGCT[T/A]AGAGCTGCCAGAGTTCTTCAGAGATAACTTTCTGGTATTGATGTTCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065868 Essential Splice Site 232 617 10 24
Genomic Location (Zv9):
Chromosome 7 (position 51848612)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50118848
GRCz11 7 50391624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGAAMAAGACAACCTGAATTTGCCAAAGTATTTCTTAWCGACAGAGG[T/G]CAGTAATTTGAAATCAGATGCATYTKCATTTTTTTCACTTGTGGAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065868 Essential Splice Site 282 617 12 24
Genomic Location (Zv9):
Chromosome 7 (position 51846186)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50116422
GRCz11 7 50389198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTCCTCTGACAAGAGTATCAAAGTGATGYTTAACTCTCAAGATAAAG[T/G]AAGAGTCACACAGACRTCATTAAGTTGACCATGATTAGAAGCAGCTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065868 Essential Splice Site 311 617 13 24
Genomic Location (Zv9):
Chromosome 7 (position 51846015)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50116251
GRCz11 7 50389027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGGCTTTTTAAGTCAGAAGGCTAAGAATCTTCAGACAGCATATGATG[T/C]AAGTGTCATGATGTAAGGCTACATATGGCGTGTGTTTTTGTAGTGCACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link