ttc17

Ensembl ID:
ENSDARG00000044812
Human Orthologue:
TTC17
Human Description:
tetratricopeptide repeat domain 17 [Source:HGNC Symbol;Acc:25596]
Mouse Orthologue:
Ttc17
Mouse Description:
tetratricopeptide repeat domain 17 Gene [Source:MGI Symbol;Acc:MGI:1921819]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38640 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41006 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065864 Essential Splice Site 100 1198 2 25
Genomic Location (Zv9):
Chromosome 7 (position 51805404)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50075640
GRCz11 7 50348416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTCATGCAGCAAGAAACCCGTGTGAACTACCTCAAGAAGTTAGAGG[T/C]GATTTTAACCCTCATGTTCATCATAATATCGTTGTAGAAACTTGGATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065864 Nonsense 948 1198 20 25
Genomic Location (Zv9):
Chromosome 7 (position 51762049)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50032285
GRCz11 7 50305061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACGAACACAGATGTTTCATCCTAATATTGGGTGTTTACAGAGAGGTG[G/A]AAGGACTACAGCAGTCTTGGTTGGCCTGGTCCTGAGGAGTGCCAGCGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link