slc4a4b

Ensembl ID:
ENSDARG00000044808
ZFIN ID:
ZDB-GENE-091030-1
Description:
Solute carrier family 4 sodium bicarbonate cotransporter member 4 [Source:UniProtKB/TrEMBL;Acc:A9XST
Human Orthologue:
SLC4A4
Human Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 4 [Source:HGNC Symbol;Acc:11030]
Mouse Orthologue:
Slc4a4
Mouse Description:
solute carrier family 4 (anion exchanger), member 4 Gene [Source:MGI Symbol;Acc:MGI:1927555]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12345 Essential Splice Site Available for shipment Available now
sa29508 Nonsense Mutation detected in F1 DNA During 2018
sa37225 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048399 Essential Splice Site 83 968 2 22
ENSDART00000138278   None 904 None 21
Genomic Location (Zv9):
Chromosome 21 (position 5955692)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 5929896
GRCz11 21 6035404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACCGAGAACGCAGAYGACTCCTCGTCCAGCATCCTCAAACCACTCAG[T/C]AAGACAAAAMAACTTTTAKTAGKATAATAAACAGGCCYAAAACTAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048399 Nonsense 281 968 7 22
ENSDART00000138278 Nonsense 100 904 3 21
Genomic Location (Zv9):
Chromosome 21 (position 5985321)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 5959525
GRCz11 21 6065033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTTTAGTTGAATAATAAATTCATGAAGAAAATCCCCCGGGATGCC[G/T]AAGCGTCAAACGTGTTGGTGGGAGAGGTGGATTTTCTCGACGCTCCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048399 Nonsense 829 968 18 22
ENSDART00000138278 Nonsense 648 904 14 21
Genomic Location (Zv9):
Chromosome 21 (position 6007462)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 5981666
GRCz11 21 6087174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTGGACCTGTTCTGGGTGTCGATTCTCCTGGTTGTGTGTTCGTTCT[T/A]GGGTTTACCATGGTATGTCGCAGCGACTGTGATCTCCATCGCCCACATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link