dck

Ensembl ID:
ENSDARG00000044807
ZFIN ID:
ZDB-GENE-041024-3
Description:
deoxycytidine kinase [Source:RefSeq peptide;Acc:NP_001007057]
Human Orthologue:
DCK
Human Description:
deoxycytidine kinase [Source:HGNC Symbol;Acc:2704]
Mouse Orthologue:
Dck
Mouse Description:
deoxycytidine kinase Gene [Source:MGI Symbol;Acc:MGI:102726]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10368 Nonsense Available for shipment Available now
sa45725 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098499 Nonsense 186 263 5 7
Genomic Location (Zv9):
Chromosome 21 (position 5873223)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 5876593
GRCz11 21 5982257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGATTATAGTTTGGATAAACRAAGAKGTTTTTGTGYTWCAGAGGTGTT[T/A]GGAGCGACTGCATCTAAGAGGAAGAGAGGAGGAGYAGGGCATWCCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098499 Nonsense 210 263 5 7
Genomic Location (Zv9):
Chromosome 21 (position 5873150)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 5876666
GRCz11 21 5982330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGGAGGAGCAGGGCATTCCTTTGGAGTATCTGGAGAAACTGCATTA[T/G]AAACATGAGTGCTGGTTACAGCACAGAACCATGAGGTACTACACAGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link