entpd2b

Ensembl ID:
ENSDARG00000044795
ZFIN ID:
ZDB-GENE-061013-2
Human Orthologue:
ENTPD2
Human Description:
ectonucleoside triphosphate diphosphohydrolase 2 [Source:HGNC Symbol;Acc:3364]
Mouse Orthologue:
Entpd2
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:1096863]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23867 Nonsense Available for shipment Available now
sa37247 Nonsense Mutation detected in F1 DNA During 2018
sa9390 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065838 Nonsense 296 504 6 9
ENSDART00000134620 Nonsense 305 377 6 9
Genomic Location (Zv9):
Chromosome 21 (position 9941204)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11424567
GRCz11 21 11517195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCTTCAGACTGAAGGAAGTGTTTGACTCGCCTTGCACGGCGTCATGG[A/T]GACCCAAACCTTACAACCCTCATTCCCACATCACAGTGCAAGGCACCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065838 Nonsense 315 504 6 9
ENSDART00000134620 Nonsense 324 377 6 9
Genomic Location (Zv9):
Chromosome 21 (position 9941261)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11424624
GRCz11 21 11517252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTTACAACCCTCATTCCCACATCACAGTGCAAGGCACCGGTGACTAC[C/T]AAAGCTGCCTTGGCAACACTTCGAAAATATTTTCTTTCAAATCCTGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065838 Essential Splice Site 350 504 6 9
ENSDART00000134620 Essential Splice Site 359 377 6 9
Genomic Location (Zv9):
Chromosome 21 (position 9941370)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11424733
GRCz11 21 11517361
KASP Assay ID:
2261-5299.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGCYTTTAATGGAGTTTTCCAGCCAAACATCAGTGGAGGCTTCATGG[T/G]GAGGGGCATWCAAACAGCCTTAATCGACTTGAAYAGAACACAATGTAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link