zgc:55870

Ensembl ID:
ENSDARG00000044597
ZFIN ID:
ZDB-GENE-040426-826
Description:
Uncharacterized protein C17orf85 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q803E1]
Human Orthologue:
C17orf85
Human Description:
chromosome 17 open reading frame 85 [Source:HGNC Symbol;Acc:24612]
Mouse Orthologue:
1200014J11Rik
Mouse Description:
RIKEN cDNA 1200014J11 gene Gene [Source:MGI Symbol;Acc:MGI:1914124]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16251 Essential Splice Site Available for shipment Available now
sa15235 Essential Splice Site Available for shipment Available now
sa23978 Nonsense Available for shipment Available now
sa707 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065504 Essential Splice Site 119 694 3 13
ENSDART00000065504 Essential Splice Site 119 694 3 13
Genomic Location (Zv9):
Chromosome 21 (position 29775956)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30976207
GRCz11 21 31012902
KASP Assay ID:
2261-5806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTGACACAGAAGRATGTGGTTCTGGAGCGGGATTTGTTGAAGAAAAG[T/A]GAGAATTCTACACAGCTGTAGATCAACACAGGATTTACACTCAACAWGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065504 Essential Splice Site 119 694 3 13
ENSDART00000065504 Essential Splice Site 119 694 3 13
Genomic Location (Zv9):
Chromosome 21 (position 29775956)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30976207
GRCz11 21 31012902
KASP Assay ID:
2261-5806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTGACACAGAAGRATGTGGTTCTGGAGCGGGATTTGTTGAAGAAAAG[T/A]GAGAATTCTACACAGCTGTAGATCAACACAGGATTTACACTCAACAWGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065504 Nonsense 354 694 9 13
Genomic Location (Zv9):
Chromosome 21 (position 29765879)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30966130
GRCz11 21 31002825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACCAAAAAGCCTCTGATTGGAGACAGCATGGGACACACTCCACCTTA[C/A]ACACATCGACACTCAGGTAAATCTCCCCTAAATAACAAACATAATTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065504 Essential Splice Site 596 694 12 13
Genomic Location (Zv9):
Chromosome 21 (position 29761979)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30962230
GRCz11 21 30998925
KASP Assay ID:
554-0615.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGACAATCGCAGTCTCTTCTCTGAACCCCCCAAAGACAAGAAAACAGG[T/C]ACACCTCAGTTCAGCACTCTTCTCAGTTCTCTTCATATTTGCTCTCCAAT
Associated Phenotype:
Data not yet available

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link