vars

Ensembl ID:
ENSDARG00000044575
ZFIN IDs:
ZDB-GENE-010601-1, ZDB-GENE-010601-1
Description:
Valyl-tRNA synthetase [Source:UniProtKB/TrEMBL;Acc:Q8JHH7]
Human Orthologue:
VARS
Human Description:
valyl-tRNA synthetase [Source:HGNC Symbol;Acc:12651]
Mouse Orthologue:
Vars
Mouse Description:
valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44838 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42669 Nonsense Mutation detected in F1 DNA During 2018
sa22767 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004832 Essential Splice Site 295 425 6 9
ENSDART00000112095 Essential Splice Site 285 1264 5 30
Genomic Location (Zv9):
Chromosome 16 (position 12048475)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10548141
GRCz11 16 10439043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGGTGTGATCACCTACAATGTCTCCACACCACCTGGAGAGAAAAAAG[G/A]TGGGCATTTGCTTCTGATACAGTCATCATATTTTATGTTATTTAATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004832   None 425 None 9
ENSDART00000112095 Nonsense 447 1264 10 30
Genomic Location (Zv9):
Chromosome 16 (position 12053437)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10553103
GRCz11 16 10444005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGTCTATTAATAATCATGCATAATATCGTCTGTTTGCAGAAACTGT[C/A]ATTTGCGGTTCAGGAGGCGTTTATACGCATGCATGAGGAGGGAGTGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004832   None 425 None 9
ENSDART00000112095 Splice Site, Nonsense 903 1264 23 30
Genomic Location (Zv9):
Chromosome 16 (position 12072699)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10572365
GRCz11 16 10463267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTGCTGTGCGTTCCTGTAACATGTTGTGTCTGTGTTTGATCTGTAG[A/T]AATCCGACTATCCCACTGGAATTCCAGAATGTGGGACTGATGCGCTTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link