ttc1

Ensembl ID:
ENSDARG00000044567
ZFIN IDs:
ZDB-GENE-041114-80, ZDB-GENE-041114-80
Description:
tetratricopeptide repeat protein 1 [Source:RefSeq peptide;Acc:NP_001007383]
Human Orthologue:
TTC1
Human Description:
tetratricopeptide repeat domain 1 [Source:HGNC Symbol;Acc:12391]
Mouse Orthologue:
Ttc1
Mouse Description:
tetratricopeptide repeat domain 1 Gene [Source:MGI Symbol;Acc:MGI:1914077]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37338 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065451 Essential Splice Site 207 319 6 8
ENSDART00000130551 Essential Splice Site 218 330 5 7
Genomic Location (Zv9):
Chromosome 21 (position 28758295)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 29977539
GRCz11 21 30014234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAATTTGAAACAAAGGTACTTGAGTGTATATTGTCTTGTCTTCCACA[G/A]CCATAGAACTTAATCCAAATTATGTCCGTGCCATTTTACGGAGAGCAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link