zgc:86706

Ensembl ID:
ENSDARG00000044562
ZFIN ID:
ZDB-GENE-040625-38
Description:
Cytochrome c [Source:UniProtKB/Swiss-Prot;Acc:Q6IQM2]
Human Orthologues:
AC012493.1, CYCS
Human Descriptions:
cytochrome c, somatic [Source:HGNC Symbol;Acc:19986]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JZN6]
Mouse Orthologues:
Cycs, Cyct, Gm10053, Gm10108, Gm10121
Mouse Descriptions:
cytochrome c, somatic Gene [Source:MGI Symbol;Acc:MGI:88578]
cytochrome c, testis Gene [Source:MGI Symbol;Acc:MGI:88579]
predicted gene 10053 Gene [Source:MGI Symbol;Acc:MGI:3704493]
predicted gene 10121 Pseudogene [Source:MGI Symbol;Acc:MGI:3708587]
predicted pseudogene 10108 Pseudogene [Source:MGI Symbol;Acc:MGI:3642431]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14125 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036456 Nonsense 99 104 3 3
Genomic Location (Zv9):
Chromosome 6 (position 10822053)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10675679
GRCz11 6 10911106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGCCGGGATCAAGAAGAAGGGCGAGAGAGCAGATCTTATTGCATACT[T/A]AAAGTCGGCCACATCATAATTCAGCTGGAGATCGAGGAARCGGCAATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link