zgc:112416

Ensembl ID:
ENSDARG00000044549
ZFIN ID:
ZDB-GENE-050417-347
Description:
hypothetical protein LOC550509 [Source:RefSeq peptide;Acc:NP_001017811]
Human Orthologue:
C21orf58
Human Description:
chromosome 21 open reading frame 58 [Source:HGNC Symbol;Acc:1300]
Mouse Orthologue:
2610028H24Rik
Mouse Description:
RIKEN cDNA 2610028H24 gene Gene [Source:MGI Symbol;Acc:MGI:1924214]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26694 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065408 Nonsense 255 271 7 8
Genomic Location (Zv9):
Chromosome 6 (position 11285165)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11138791
GRCz11 6 11374218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGGACTTTTCTGCCACATGGGATTGGTTCTGTAACTCTGCCCCCCT[T/G]AAACACGTAAGAAACAACAGTGTAAAACTTCCTACTCTGCTAGTTGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link