zgc:110782

Ensembl ID:
ENSDARG00000044544
ZFIN ID:
ZDB-GENE-050320-51
Description:
hypothetical protein LOC541358 [Source:RefSeq peptide;Acc:NP_001013503]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17964 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065401 Nonsense 177 287 2 2
ENSDART00000133152 Nonsense 177 226 2 2
Genomic Location (Zv9):
Chromosome 21 (position 26587587)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27156498
GRCz11 21 27193193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTGCTCGCGAGTTGCCGTGTTCCCCCAGCGRTCCTTCAGATAGAATG[T/A]CAACCAAAGYTKATCCAGAGGGAACTGAGGGATTTATGCATGGAGACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link