zgc:153208

Ensembl ID:
ENSDARG00000044541
ZFIN ID:
ZDB-GENE-060825-331
Description:
protein phosphatase 1 regulatory subunit 14B [Source:RefSeq peptide;Acc:NP_001039318]
Human Orthologue:
PPP1R14B
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 14B [Source:HGNC Symbol;Acc:9057]
Mouse Orthologues:
4933415F23Rik, Ppp1r14b
Mouse Descriptions:
protein phosphatase 1, regulatory (inhibitor) subunit 14B Gene [Source:MGI Symbol;Acc:MGI:107682]
RIKEN cDNA 4933415F23 gene Gene [Source:MGI Symbol;Acc:MGI:1914005]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9966 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065398 Nonsense 57 130 2 5
ENSDART00000126542 Nonsense 57 130 2 5
ENSDART00000144342 Nonsense 57 130 1 4

The following transcripts of ENSDARG00000044541 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 26404738)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26973649
GRCz11 21 27010344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGAGCTGAGGAGGAGGCTGAATTTGGAAGAGTGGATAGTTAGCCAGT[T/A]AATGAATCTGTACGACTGCGAGGTAGGAMACAAAACACTGTCACTGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link