slc15a1b

Ensembl ID:
ENSDARG00000044528
ZFIN ID:
ZDB-GENE-030131-4661
Description:
solute carrier family 15 (oligopeptide transporter), member 1b [Source:RefSeq peptide;Acc:NP_932330
Human Orthologue:
SLC15A1
Human Description:
solute carrier family 15 (oligopeptide transporter), member 1 [Source:HGNC Symbol;Acc:10920]
Mouse Orthologue:
Slc15a1
Mouse Description:
solute carrier family 15 (oligopeptide transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:186137

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33827 Essential Splice Site Available for shipment Available now
sa20664 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047896 Essential Splice Site 220 718 8 23
Genomic Location (Zv9):
Chromosome 6 (position 12490309)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12343531
GRCz11 6 12578389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCCTCTGGCGTTTGGCGTTCCTGCAGCGCTCATGGTGGTTGCCCTCA[G/A]TAAGTTACAGCAGTTTGCTTTTATTTTGATGTGTGCAATGCTCCTTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047896 Essential Splice Site 249 718 10 23
Genomic Location (Zv9):
Chromosome 6 (position 12487066)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12340288
GRCz11 6 12575146
KASP Assay ID:
2259-7278.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCTCATCCAATTTTTATTAAATGACTGTTGTTGTTTTCTCTTCTGCA[G/A]TTTGCGCTTAATAACCGTTTCAGACATCGCGGTAAACAGTACCCAAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link