
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
DEF6 (2 of 2)
- Ensembl ID:
- ENSDARG00000044524
- Description:
- differentially expressed in FDCP 6 homolog (mouse) [Source:HGNC Symbol;Acc:2760]
- Human Orthologue:
- DEF6
- Human Description:
- differentially expressed in FDCP 6 homolog (mouse) [Source:HGNC Symbol;Acc:2760]
- Mouse Orthologue:
- Def6
- Mouse Description:
- differentially expressed in FDCP 6 Gene [Source:MGI Symbol;Acc:MGI:1346328]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39353 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa29683 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39353
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065377 | Essential Splice Site | 79 | 615 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 22 (position 960621)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 963533 GRCz11 22 980431 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCCAGCCAGGGGTACATGCCCTACCTGAACCAGTTCATTCTGGACAAG[G/A]TGCAAAACAACACACACAAATACACACACACAAACACACACACTTTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29683
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065377 | Nonsense | 529 | 615 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 22 (position 972634)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 975546 GRCz11 22 992444 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGATTTAGCAGCATATTCATGAGTTTATCCATCCGCAGGCTGCTCAGCGT[A/T]AACTCCGGCAGGCCAGTACGAGTGTTAAACACTGGAACGTCCAGATGAAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Many sequence variants affecting diversity of adult human height. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: