si:dkey-225f3.3

Ensembl ID:
ENSDARG00000044512
ZFIN ID:
ZDB-GENE-091118-29
Description:
LOC407683 protein [Source:UniProtKB/TrEMBL;Acc:Q6NWD3]
Human Orthologue:
CA4
Human Description:
carbonic anhydrase IV [Source:HGNC Symbol;Acc:1375]
Mouse Orthologue:
Car4
Mouse Description:
carbonic anhydrase 4 Gene [Source:MGI Symbol;Acc:MGI:1096574]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31062 Nonsense Mutation detected in F1 DNA During 2018
sa43677 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065362 Nonsense 63 309 3 8
ENSDART00000065362 Nonsense 63 309 3 8
Genomic Location (Zv9):
Chromosome 21 (position 30048617)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31248868
GRCz11 21 31285563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGTCAGAAGCAATCGCCTATCAACATCATCACAAGCAAAGTGAAGTA[T/A]GACCCAAAACTGACCAGTTTTATCTTTCATGGTCATGAGGATGCTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065362 Nonsense 63 309 3 8
ENSDART00000065362 Nonsense 63 309 3 8
Genomic Location (Zv9):
Chromosome 21 (position 30048617)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31248868
GRCz11 21 31285563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGTCAGAAGCAATCGCCTATCAACATCATCACAAGCAAAGTGAAGTA[T/A]GACCCAAAACTGACCAGTTTTATCTTTCATGGTCATGAGGATGCTTTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link