zgc:112061

Ensembl ID:
ENSDARG00000044491
ZFIN ID:
ZDB-GENE-050522-252
Description:
kinesin family member 20A [Source:RefSeq peptide;Acc:NP_001154942]
Human Orthologue:
KIF20A
Human Description:
kinesin family member 20A [Source:HGNC Symbol;Acc:9787]
Mouse Orthologue:
Kif20a
Mouse Description:
kinesin family member 20A Gene [Source:MGI Symbol;Acc:MGI:1201682]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29638 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32355 Essential Splice Site Available for shipment Available now
sa7483 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065337 Essential Splice Site 139 921 4 19
ENSDART00000124273 Essential Splice Site 139 921 3 18
Genomic Location (Zv9):
Chromosome 21 (position 33887251)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34886944
GRCz11 21 34921434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGAGAGAGGGGTCGCTCAAAGTGTGCACAAATTTACATTTACAAAGG[T/C]AATGGACACAAACAAATATAGACTGGTCATGGAATATTTGGAAAATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065337 Essential Splice Site 185 921 5 19
ENSDART00000124273 Essential Splice Site 185 921 4 18
Genomic Location (Zv9):
Chromosome 21 (position 33884087)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34883780
GRCz11 21 34918270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTATACTTACGGTGTGACTAACTCCGGCAAAACCTACACCATACAAG[G/A]TAAGGTGGCTGCTTAATGCATTTTGGATTTTGGCGCATTATATTTCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065337 Missense 504 921 12 19
ENSDART00000124273 Missense 504 921 11 18
Genomic Location (Zv9):
Chromosome 21 (position 33863427)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34863120
GRCz11 21 34897610
KASP Assay ID:
554-4280.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGAACATCAACCCYTGTGCCTCCACCTATGATGAGACACTCCAAGCAC[T/C]CAAATTCTCTGCWATTGCCACACAGGTGAAAATACTCTTCATTTTTCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link