
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tlr9
- Ensembl ID:
- ENSDARG00000044490
- ZFIN ID:
- ZDB-GENE-040219-10
- Description:
- toll-like receptor 9 [Source:RefSeq peptide;Acc:NP_001124066]
- Human Orthologues:
- RP11-330H6.5, TLR9
- Human Descriptions:
- TLR9 [Source:UniProtKB/TrEMBL;Acc:C3W5P5]
- toll-like receptor 9 [Source:HGNC Symbol;Acc:15633]
- Mouse Orthologue:
- Tlr9
- Mouse Description:
- toll-like receptor 9 Gene [Source:MGI Symbol;Acc:MGI:1932389]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34528 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1171 | Nonsense | Confirmed mutation in F2 line | During 2018 |
sa10328 | Nonsense | Available for shipment | Available now |
sa12600 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34528
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124218 | Nonsense | 554 | 1069 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 8 (position 55865486)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 53902216 GRCz11 8 53731936 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCCACCAATTCTCACATCTGAGCAAACTATCTTACCTTAATATGGCGTA[C/A]AACCGTATTGACCTGTATTCCGACAAGGCCTTTCAGGAGGTCAGTGGCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1171
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124218 | Nonsense | 642 | 1069 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 8 (position 55865749)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 53901953 GRCz11 8 53731673 - KASP Assay ID:
- 554-1081.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAGTATCTCATTTTCTCTGGGAATCGTTTGGACATATTGTGGGACTCTT[G/A]GCGTAATCAATACATAAACCTCTTTCAGGGACTCACCAACCTTACGCACT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa10328
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124218 | Nonsense | 732 | 1069 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 8 (position 55866019)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 53901683 GRCz11 8 53731403 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCRTACTTRCCYAATATTAACWTTGAGCTCCRKCTCACAGGACTGGATT[T/G]AAGTCACAACCGACTGGTTGCAATTCCAAAGGTATTCCTTAGTCAGKCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12600
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124218 | Nonsense | 1045 | 1069 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 8 (position 55866959)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 53900743 GRCz11 8 53730463 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGTCAGTTCTGTCCTGGCCCAGAAAYCCMYGAGTGCAGCCGCTCTTCTG[G/A]AATGACCTGCGCGTCGCTCTCGTTTCTGACAATRTTAGAGCCTACAACAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: