zgc:110222

Ensembl ID:
ENSDARG00000044480
ZFIN ID:
ZDB-GENE-050417-121
Description:
hypothetical protein LOC550336 [Source:RefSeq peptide;Acc:NP_001017643]
Human Orthologues:
CXorf40A, CXorf40B
Human Descriptions:
chromosome X open reading frame 40A [Source:HGNC Symbol;Acc:28089]
chromosome X open reading frame 40B [Source:HGNC Symbol;Acc:17402]
Mouse Orthologue:
1110012L19Rik
Mouse Description:
RIKEN cDNA 1110012L19 gene Gene [Source:MGI Symbol;Acc:MGI:1915868]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25164 Nonsense Mutation detected in F1 DNA During 2018
sa37353 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065318 Nonsense 47 173 1 3
Genomic Location (Zv9):
Chromosome 21 (position 33045174)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34044867
GRCz11 21 34079357
KASP Assay ID:
554-7384.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCTGCTGTCAGAGATGCAGAACAGCACTCTAGCTGTTCATATTGCTT[G/A]GAAAAGCTGGGAAGGAGAGGACTGGAGGCTCATTCTCACTGAAAGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065318 Nonsense 69 173 1 3
Genomic Location (Zv9):
Chromosome 21 (position 33045239)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34044932
GRCz11 21 34079422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGACTGGAGGCTCATTCTCACTGAAAGACTGGGAATGACATCCAAA[C/T]AAACGGAGGAACTCCTGGAGTCGGGAGAAAGGTTCGGGCGGAGTGTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link