zgc:110460

Ensembl ID:
ENSDARG00000044479
ZFIN IDs:
ZDB-GENE-040426-2603, ZDB-GENE-050626-52
Description:
Eukaryotic translation initiation factor 2A [Source:UniProtKB/Swiss-Prot;Acc:Q4QRJ7]
Human Orthologue:
EIF2A
Human Description:
eukaryotic translation initiation factor 2A, 65kDa [Source:HGNC Symbol;Acc:3254]
Mouse Orthologue:
Eif2a
Mouse Description:
eukaryotic translation initiation factor 2a Gene [Source:MGI Symbol;Acc:MGI:1098684]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15233 Essential Splice Site Available for shipment Available now
sa10155 Nonsense Available for shipment Available now
sa19191 Nonsense Mutation detected in F1 DNA During 2018
sa23204 Essential Splice Site Available for shipment Available now
sa36555 Nonsense Available for shipment Available now
sa795 Essential Splice Site Available for shipment Available now
sa43024 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074168 Essential Splice Site 158 580 6 24
Genomic Location (Zv9):
Chromosome 18 (position 2460200)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3468102
GRCz11 18 3565187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCGAAATGTCAATAATGAGCTTCACTTTTTTGAAAACAACAACTTTGG[T/A]GAGACATTGTTTGCTTTGTTTATTGTGCATGTTAKGTTTTAAATGARTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074168 Nonsense 268 580 9 24
ENSDART00000074168 Nonsense 268 580 9 24
Genomic Location (Zv9):
Chromosome 18 (position 2463741)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3464561
GRCz11 18 3561646
KASP Assay ID:
2261-1701.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGCAGACGCTACATTACGTCGCCACCAATGGAGAAAGTGCTGTCGTT[C/T]AGCTACGTAAGTAACATATTAAGTKAGTAATTAACTACTAGGGCTGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074168 Nonsense 268 580 9 24
ENSDART00000074168 Nonsense 268 580 9 24
Genomic Location (Zv9):
Chromosome 18 (position 2463741)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3464561
GRCz11 18 3561646
KASP Assay ID:
2261-1701.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCAGACGCTACATTACGTCGCCACCAATGGAGAAAGTGCTGTCGTT[C/T]AGCTACGTAAGTAACATATTAAGTTAGTAATTAACTACTAGGGCTGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074168 Essential Splice Site 269 580 9 24
Genomic Location (Zv9):
Chromosome 18 (position 2463748)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3464554
GRCz11 18 3561639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCTACATTACGTCGCCACCAATGGAGAAAGTGCTGTCGTTCAGCTAC[G/A]TAAGTAACATATTAAGTTAGTAATTAACTACTAGGGCTGCACAATATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074168 Nonsense 564 580 14 24
Genomic Location (Zv9):
Chromosome 18 (position 2472588)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3455714
GRCz11 18 3552799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAAAACCATAATTATAACATTTCCCCTTTTTTACAGCTTGAGAAGATG[C/T]AGAAGGAGGCCCAGCTGTTGAAAGAGCTTGAAGACCTTGAATTAGGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074168 Essential Splice Site None 580 18 24
Genomic Location (Zv9):
Chromosome 18 (position 2483204)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3445098
GRCz11 18 3542183
KASP Assay ID:
554-0700.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCATTTCTCCAACAAGAAATGCCTCGCCTGGTTTTATGAATATGCAGG[T/G]ATGTGAATCGTAGCGGTTAACATGAAACTGCATTTACAAACTGATCTTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa43024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074168 Essential Splice Site None 580 21 24
Genomic Location (Zv9):
Chromosome 18 (position 2485444)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3442858
GRCz11 18 3539943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCGGTTATATTCAAGAGTATCTACAGATACGCCTTTGACTTTGCCAGG[G/A]TGAGATGTGTTTAGAGAAGATGATGCATTTGAGGCTACAAATCCCTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link