
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
CDHR1 (2 of 2)
- Ensembl ID:
- ENSDARG00000044447
- Description:
- cadherin-related family member 1 [Source:HGNC Symbol;Acc:14550]
- Human Orthologues:
- CDH23, CDHR1
- Human Descriptions:
- cadherin-related 23 [Source:HGNC Symbol;Acc:13733]
- cadherin-related family member 1 [Source:HGNC Symbol;Acc:14550]
- Mouse Orthologue:
- Cdhr1
- Mouse Description:
- cadherin-related family member 1 Gene [Source:MGI Symbol;Acc:MGI:2157782]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35383 | Nonsense | Available for shipment | Available now |
sa22186 | Essential Splice Site | Available for shipment | Available now |
sa18079 | Nonsense | Available for shipment | Available now |
sa22185 | Essential Splice Site | Available for shipment | Available now |
sa35382 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa22184 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35383
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065278 | Nonsense | 39 | 755 | 1 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 50606370)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 48973214 GRCz11 12 48994743 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTTTGATAAGGGCTCTAAACAGTTCTTCAGTGTGGAGCCCAAATCTGGC[A/T]GAGTGACCCTGGTGGAGCATCTGGACAGAGAGGTCAGAGGTCATGCGAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22186
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065278 | Essential Splice Site | 156 | 755 | 5 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 50600187)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 48967031 GRCz11 12 48988560 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCTGGACTTTGAGACGTCACGGACACATTTCATCACTGTGGTGGCAAAG[G/A]TGAAGCCCTGAGCATCCAGCGCTCATGTGGATCTTCAACAAAAGTGTTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18079
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065278 | Nonsense | 203 | 755 | 7 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 50599406)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 48966250 GRCz11 12 48987779 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCAYGAGGTGCAGAAACTGAGCTCTSCTSATGGTTTTGTGTCCAGGGTT[C/A]AGAGATTTTTACTGTTTTTGCGAAGGATGGAGMCCAGAGCAGCCCCAACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22185
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065278 | Essential Splice Site | 330 | 755 | 9 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 50597134)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 48963978 GRCz11 12 48985507 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGGAGAAATCCTGCGCGGACTAAAGATCACTGTCAACGACTCCGACCAG[G/A]TGAAGGGCACTGAACACTAAACAGTGGACACTAGACAGTGAACACTAAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35382
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065278 | Essential Splice Site | 536 | 755 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 50593999)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 48960843 GRCz11 12 48982372 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATTAGAGCGATGATACATCTGTGGTTATGTGAATACCCGACTGTGTTCA[G/A]GCGGTGGACGAGGACGCAGAGGAGCCCAATAACCTGATCGAGTACTCCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22184
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065278 | Nonsense | 583 | 755 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 50593857)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 48960701 GRCz11 12 48982230 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCACGGGCGAGATCAAGCTCAAACCCTACATCAAGAGTCTGGAGATCGTG[C/T]AGAACATCAGTAGGCAGAGGGAGTGCCGCTGGTCCGTGGTGGTGCAGGCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: