zgc:153492

Ensembl ID:
ENSDARG00000044440
ZFIN ID:
ZDB-GENE-061110-55
Description:
hypothetical protein LOC777754 [Source:RefSeq peptide;Acc:NP_001071263]
Human Orthologue:
WDR48
Human Description:
WD repeat domain 48 [Source:HGNC Symbol;Acc:30914]
Mouse Orthologue:
Wdr48
Mouse Description:
WD repeat domain 48 Gene [Source:MGI Symbol;Acc:MGI:1914811]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9279 Nonsense Mutation detected in F1 DNA During 2018
sa6783 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37968 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44201 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105610 Nonsense 118 524 5 15
Genomic Location (Zv9):
Chromosome 24 (position 42630998)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41189185
GRCz11 24 40888979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGTTTTTTTATTTGCTGATAATACTATATATTTGTTTTTTAGGACTA[T/A]GTTAAAGCATTAGCGTATGCTAAAGACAAAGAGCTGGTGGCTTCAGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105610 Essential Splice Site 160 524 5 15
Genomic Location (Zv9):
Chromosome 24 (position 42630872)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41189059
GRCz11 24 40888853
KASP Assay ID:
554-4291.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTGAACACACTGACAGCGCTGACCGCATCCAACAACACCGTCACTAG[T/G]GAGTTTACAATACASTCTAAAACCTACTGAACTTTGAGTCAAATATRAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105610 Essential Splice Site 189 524 6 15
Genomic Location (Zv9):
Chromosome 24 (position 42627774)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41185961
GRCz11 24 40885755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCATGAATCAGATGGGGACGGTTATAGTTTCGGGATCCACTGAAAAG[G/A]TTTGAGGCATCACAATGCTTTTAATGTCCATGATATGACAGCAGCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105610 Nonsense 241 524 8 15
Genomic Location (Zv9):
Chromosome 24 (position 42625933)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41184120
GRCz11 24 40883914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGTCAGGCAGTTCAGACGGGACGATCCGGCTCTGGTCTTTGGGTCAG[C/T]AGCGGTGCATCGCCACGTATCGCGTCCATGATGAAGGTGTGTGGGCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link