si:dkey-273o13.5

Ensembl ID:
ENSDARG00000044436
ZFIN ID:
ZDB-GENE-060526-284
Description:
ribosomal protein S6 kinase alpha-4 [Source:RefSeq peptide;Acc:NP_001119875]
Human Orthologue:
RPS6KA4
Human Description:
ribosomal protein S6 kinase, 90kDa, polypeptide 4 [Source:HGNC Symbol;Acc:10433]
Mouse Orthologue:
Rps6ka4
Mouse Description:
ribosomal protein S6 kinase, polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:1930076]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10999 Nonsense Available for shipment Available now
sa38527 Nonsense Mutation detected in F1 DNA During 2018
sa20581 Essential Splice Site Available for shipment Available now
sa40597 Nonsense Mutation detected in F1 DNA During 2018
sa38526 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065262 Nonsense 112 745 4 17
Genomic Location (Zv9):
Chromosome 5 (position 70104238)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66430396
GRCz11 5 67108765
KASP Assay ID:
2259-6837.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACACCTCTATCAGAGAGATCAKTTCTCAGAGGATGAGGTGAGGATCTA[T/A]GTGGGGGAGATTATTCTGGCTCTGGAGCATCTGCATAAGGTACTGCTGCM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065262 Nonsense 140 745 5 17
Genomic Location (Zv9):
Chromosome 5 (position 70104033)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66430191
GRCz11 5 67108560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAGCTTGGCATTGTGTACCGAGACATTAAGCTGGAGAACATTTTAT[T/A]GGACAGTGATGGTCATGTGGTTTTGACAGACTTTGGGCTGAGTAAGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065262 Essential Splice Site 369 745 10 17
Genomic Location (Zv9):
Chromosome 5 (position 70091805)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66417963
GRCz11 5 67096332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTGACCGGCCTGGTTCTGCTACAGTCCAGCGTAGTGCAATGCTGAAG[G/A]TGAACAACTGCTTCTGTAAAAATGATTAAATAAATGAAAAAAGGTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065262 Nonsense 559 745 14 17
Genomic Location (Zv9):
Chromosome 5 (position 70082398)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66408556
GRCz11 5 67086925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTACGCAGCGCCTGAGCTCTTCCACAGCTCGGGATATGACCAGGCGTG[T/A]GACCTCTGGAGCCTTGGGGTCATATTGGTAAGTGTGTGTGTATCAAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065262 Essential Splice Site 569 745 15 17
Genomic Location (Zv9):
Chromosome 5 (position 70080629)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66406787
GRCz11 5 67085156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATATATTTAAACAAATACTGATACAGGTAGTGTTTTTCTTCTTCTT[A/C]GTACACCATGCTCTCTGGCCAAGTTCCATTCCAGAGTGAGAAAAAAGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link