sned1

Ensembl ID:
ENSDARG00000044433
Human Orthologue:
SNED1
Human Description:
sushi, nidogen and EGF-like domains 1 [Source:HGNC Symbol;Acc:24696]
Mouse Orthologue:
Sned1
Mouse Description:
sushi, nidogen and EGF-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:3045960]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26752 Nonsense Mutation detected in F1 DNA During 2018
sa20710 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa26752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065255 Nonsense 552 1374 13 32
Genomic Location (Zv9):
Chromosome 6 (position 27178164)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27479375
GRCz11 6 27469936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGGTGAAGCTGGTGCGTGTGTTTTTCAGTACAGCCCCAATCAGCCTG[C/A]GACTCCTCTCCGTGTCAGAATGGAGGGTATTGCTATGAAAGAGATGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065255 Essential Splice Site 730 1374 16 32
Genomic Location (Zv9):
Chromosome 6 (position 27183780)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27484991
GRCz11 6 27475552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCATCTGCAGCAGCCAGGGGTCCTGGAGCCAGCCTCCAGTCTGTGAAG[G/T]TTAGTGTAGACTTACTGTATATTCAAAACCCTTGTTGTTCAAAGTTTGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link