
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
disp1
- Ensembl ID:
- ENSDARG00000044417
- ZFIN IDs:
- ZDB-GENE-030911-7, ZDB-GENE-030911-7, ZDB-GENE-030911-7
- Description:
- Protein dispatched homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6R5J2]
- Human Orthologue:
- DISP1
- Human Description:
- dispatched homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19711]
- Mouse Orthologue:
- Disp1
- Mouse Description:
- dispatched homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1916147]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23822 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23822
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065231 | Nonsense | 746 | 1464 | 9 | 9 |
ENSDART00000074150 | Nonsense | 746 | 1464 | 8 | 8 |
ENSDART00000099486 | Nonsense | 214 | 932 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 51828889)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 51678328 GRCz11 20 51491440 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGCTCTCAGAATTTCAAGTGTTTCGCTCCTCGCATCCCTTTGAACGCTA[T/G]GATGCGGAGTACAAAAAACTCTTCATGTTTGAACGGGTCAACCATGGGGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: