zgc:171930

Ensembl ID:
ENSDARG00000044406
ZFIN IDs:
ZDB-GENE-070928-35, ZDB-GENE-070928-35
Description:
hypothetical protein LOC100126029 [Source:RefSeq peptide;Acc:NP_001099178]
Human Orthologue:
C1orf190
Human Description:
chromosome 1 open reading frame 190 [Source:HGNC Symbol;Acc:32327]
Mouse Orthologue:
1520402A15Rik
Mouse Description:
RIKEN cDNA 1520402A15 gene Gene [Source:MGI Symbol;Acc:MGI:1915325]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8689 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065215 Nonsense 267 286 3 3
ENSDART00000127675 Nonsense 267 286 2 2
Genomic Location (Zv9):
Chromosome 6 (position 30322674)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30643590
GRCz11 6 30630504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAAATGGCAAGGTTGAGCTGGAGAGCTGTAAAAAGAATGGCAAAGTT[C/T]AACTGGAGTACGATGCACACTGGCGTTGGGTTCAGTCGMAGGATGATGTM
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link