zgc:193690

Ensembl ID:
ENSDARG00000044325
ZFIN ID:
ZDB-GENE-080721-12
Description:
ATP-dependent RNA helicase DDX19A [Source:RefSeq peptide;Acc:NP_001122187]
Human Orthologues:
DDX19A, DDX19B
Human Descriptions:
DEAD (Asp-Glu-Ala-As) box polypeptide 19A [Source:HGNC Symbol;Acc:25628]
DEAD (Asp-Glu-Ala-As) box polypeptide 19B [Source:HGNC Symbol;Acc:2742]
Mouse Orthologues:
Ddx19a, Ddx19b
Mouse Descriptions:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a Gene [Source:MGI Symbol;Acc:MGI:99526]
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b Gene [Source:MGI Symbol;Acc:MGI:2148251]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24391 Nonsense Available for shipment Available now
sa24390 Essential Splice Site, Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102886 Nonsense 176 471 7 12
ENSDART00000134461 Nonsense 176 492 7 12
ENSDART00000146835 Nonsense 160 168 7 7
Genomic Location (Zv9):
Chromosome 23 (position 37202115)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37001343
GRCz11 23 37104005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTCCCCCACATATGAGCTGGCTCTGCAGACGGGCAAAGTCATCGAG[C/T]AGATGGGCAAATTTTATCCGGAAGTCACACTGGCATATGCAGTTCGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102886 Splice Site None 471 None 12
ENSDART00000134461 Essential Splice Site 453 492 11 12
ENSDART00000146835   None 168 None 7
Genomic Location (Zv9):
Chromosome 23 (position 37196946)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36996174
GRCz11 23 37098836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCAGCGCAGCATGGAGATTCTCAAGACATACGAGAGGCATTTTGGCAA[G/A]TCTTTTTCATCATTAAAATAAATAGTTAACCCAATTTTACTTAATATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link