zgc:152845

Ensembl ID:
ENSDARG00000044282
ZFIN IDs:
ZDB-GENE-040426-1624, ZDB-GENE-061013-288
Description:
structural maintenance of chromosomes protein 5 [Source:RefSeq peptide;Acc:NP_001180470]
Human Orthologue:
SMC5
Human Description:
structural maintenance of chromosomes 5 [Source:HGNC Symbol;Acc:20465]
Mouse Orthologue:
Smc5
Mouse Description:
structural maintenance of chromosomes 5 Gene [Source:MGI Symbol;Acc:MGI:2385088]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45399 Nonsense Mutation detected in F1 DNA During 2018
sa34865 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065017 Nonsense 198 400 5 19
ENSDART00000101191 Nonsense 198 697 5 16
ENSDART00000122170 Nonsense 198 1073 5 24
ENSDART00000138389 Nonsense 198 445 5 10

The following transcripts of ENSDARG00000044282 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15670894)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15684201
GRCz11 10 15642320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAACTTCTTGAAGCCACTGAGAAATCTGTCGGCCCACCAGAAATGTA[C/G]GAATTTCACTGTGAGCTCAAGACATTTCGCACCAAAGAGAGAGATTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065017   None 400 None 19
ENSDART00000101191   None 697 None 16
ENSDART00000122170 Nonsense 572 1073 13 24
ENSDART00000138389   None 445 None 10

The following transcripts of ENSDARG00000044282 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15663418)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15676725
GRCz11 10 15634844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGAGAGATGTTTGATGCTCCTGAGGAGGTTATGAGTTATTTATGCCAT[C/T]AGTACAGAGTTAACGATGTACCAATAGGAACAGAGAAGACCAAGGGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link