zgc:152984

Ensembl ID:
ENSDARG00000044281
ZFIN ID:
ZDB-GENE-061103-403
Description:
protein LAP2 [Source:RefSeq peptide;Acc:NP_001180472]
Human Orthologue:
ERBB2IP
Human Description:
erbb2 interacting protein [Source:HGNC Symbol;Acc:15842]
Mouse Orthologue:
Erbb2ip
Mouse Description:
Erbb2 interacting protein Gene [Source:MGI Symbol;Acc:MGI:1890169]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9217 Nonsense Mutation detected in F1 DNA During 2018
sa2551 Nonsense F2 line generated During 2018
sa31770 Essential Splice Site, Missense Available for shipment Available now
sa21689 Nonsense Available for shipment Available now
sa13728 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016888 Nonsense 29 636 2 18
ENSDART00000087680   None 590 None 18
ENSDART00000123935 Nonsense 29 1349 2 25
ENSDART00000129441 Nonsense 29 1384 1 25

The following transcripts of ENSDARG00000044281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15540566)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15553873
GRCz11 10 15511992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTGCCGCTGCCTGCGGGGCGAGGAGGAGACYGTCACCACACTGGACTA[C/A]TCGCACTGCAGCCTGGAGCAGGTCCCTAAAGAGATCTTCAGCTTCGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2551
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016888 Nonsense 529 636 16 18
ENSDART00000087680 Nonsense 513 590 17 18
ENSDART00000123935 Nonsense 529 1349 16 25
ENSDART00000129441 Nonsense 530 1384 15 25

The following transcripts of ENSDARG00000044281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15604023)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15617330
GRCz11 10 15575449
KASP Assay ID:
554-2907.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGGCTGGAAAAGAGCCCAGGGTCAGCGAGAGGAACCATATCGGAGTG[C/T]AGGACGTTGGAGTGAAGGTTGGAGTTTAAAAACACTTCCAAATTCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016888 Essential Splice Site 593 636 None 18
ENSDART00000087680 Missense 578 590 18 18
ENSDART00000123935 Essential Splice Site 593 1349 None 25
ENSDART00000129441 Essential Splice Site 594 1384 None 25

The following transcripts of ENSDARG00000044281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15604353)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15617660
GRCz11 10 15575779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTCAGACAACATGAGAACTATGGTGAACCACGATGACACGCTTGAGG[T/C]ACTGTATCATTGTTTAAAGAGCTCCTATTTTGCTTTATAAAAGCTCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016888   None 636 None 18
ENSDART00000087680   None 590 None 18
ENSDART00000123935 Nonsense 965 1349 20 25
ENSDART00000129441 Nonsense 971 1384 19 25

The following transcripts of ENSDARG00000044281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15611419)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15624726
GRCz11 10 15582845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAAACCTCCGGTAAGCAGCACTCGCTACCCTGCCGGCCCCCCACCA[C/T]AGTATAACATCCAATATGCCAGCAGCACTGTGCCCAAAGATAACCTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016888   None 636 None 18
ENSDART00000087680   None 590 None 18
ENSDART00000123935 Nonsense 1019 1349 20 25
ENSDART00000129441 Nonsense 1025 1384 19 25

The following transcripts of ENSDARG00000044281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 15611581)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15624888
GRCz11 10 15583007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCAACTTTTCCAACCGCAACAATGCCCCTCCATACCCCCAGYCTCAA[C/T]AGCGTGGACCGCCCAAGACCCCAGACATGTGGGCCAAGGAAAGAATGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link