snx18b

Ensembl ID:
ENSDARG00000044246
ZFIN ID:
ZDB-GENE-080213-6
Description:
sorting nexin 18b [Source:RefSeq peptide;Acc:NP_001015063]
Human Orthologue:
SNX18
Human Description:
sorting nexin 18 [Source:HGNC Symbol;Acc:19245]
Mouse Orthologue:
Snx18
Mouse Description:
sorting nexin 18 Gene [Source:MGI Symbol;Acc:MGI:2137642]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45395 Nonsense Mutation detected in F1 DNA During 2018
sa1526 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa45395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064966 Nonsense 241 563 1 2
Genomic Location (Zv9):
Chromosome 10 (position 9184210)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9260166
GRCz11 10 9093725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCTACAAAACAGACCAAATTCAAAGGTATGAAGAGCTATATGTCCTA[C/A]GGACTCACGCCGAGTCATACTCAAAGCCAGGTGAATCGAAGATACAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1526
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064966 Nonsense 254 563 1 2
Genomic Location (Zv9):
Chromosome 10 (position 9184247)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9260203
GRCz11 10 9093762
KASP Assay ID:
554-1450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTATATGTCCTACGGACTCACGCCGAGTCATACTCAAAGCCAGGTGAAT[C/T]GAAGATACAAGCACTTTGATTGGCTTTATGCGCGACTTGTTGAAAAGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link