zgc:158628

Ensembl ID:
ENSDARG00000044204
ZFIN ID:
ZDB-GENE-070112-2012
Description:
Poly(U)-specific endoribonuclease-A [Source:UniProtKB/Swiss-Prot;Acc:A1L237]
Human Orthologue:
ENDOU
Human Description:
endonuclease, polyU-specific [Source:HGNC Symbol;Acc:14369]
Mouse Orthologue:
Endou
Mouse Description:
endonuclease, polyU-specific Gene [Source:MGI Symbol;Acc:MGI:97746]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33918 Nonsense Mutation detected in F1 DNA During 2018
sa33919 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9974 Essential Splice Site Available for shipment Available now
sa17233 Essential Splice Site, Missense Available for shipment Available now
sa40753 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064904 Nonsense 8 303 1 8
ENSDART00000114115 Nonsense 8 305 1 7
Genomic Location (Zv9):
Chromosome 6 (position 39836278)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39907878
GRCz11 6 39905414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTGTGTTTAACGGATCGTCTAACAATGAAGATCATCCTCATACTTTG[T/A]CTCAGCATCACCCTGATCTCTCAGGGCCACTTTGGTAAGTTCATGCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064904   None 303 None 8
ENSDART00000114115 Essential Splice Site 20 305 2 7
Genomic Location (Zv9):
Chromosome 6 (position 39839300)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39910900
GRCz11 6 39908436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTTTAATTCTTTTTAAGTGCTTCTTTGCTCTTTGGGTATTAATGTTT[T/A]CTTTATGTGCACGTTTTTCAAGCATTGGCCAATGTGTCAGATGCAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064904   None 303 None 8
ENSDART00000114115 Essential Splice Site 20 305 2 7
Genomic Location (Zv9):
Chromosome 6 (position 39839301)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39910901
GRCz11 6 39908437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTTAATTCTTTTTAAGTGCTTCTTTGCTCTTTGGGTATTAATGTTTT[C/T]TTTATGTGCACGTTTTTCAAGCATTGGCCAATGTGTCAGATGCAGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064904 Essential Splice Site 25 303 None 8
ENSDART00000114115 Missense 26 305 2 7
Genomic Location (Zv9):
Chromosome 6 (position 39839321)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39910921
GRCz11 6 39908457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCTTTGCTCTTTGGGTATTAATGTTTTYTTTATGTGCACGTTTTTCA[A/T]GCATTGGCCAATGTGTCAGATGCAGAGATCAAGTCTCTGTCAGAGACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064904 Nonsense 237 303 7 8
ENSDART00000114115 Nonsense 239 305 6 7
Genomic Location (Zv9):
Chromosome 6 (position 39842461)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39914061
GRCz11 6 39911597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGTATCCTGATGTATTGGGAATGCAGTTTAACTGGGATGGATATTTC[A/T]AAGAGCTGGGTTCTGCCTTTATTGGCTGTAGTCCTGAGTTTGATCTGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link