sumf1

Ensembl ID:
ENSDARG00000044203
ZFIN ID:
ZDB-GENE-060421-3113
Description:
sulfatase-modifying factor 1 [Source:RefSeq peptide;Acc:NP_001035430]
Human Orthologue:
SUMF1
Human Description:
sulfatase modifying factor 1 [Source:HGNC Symbol;Acc:20376]
Mouse Orthologue:
Sumf1
Mouse Description:
sulfatase modifying factor 1 Gene [Source:MGI Symbol;Acc:MGI:1889844]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31531 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064903 Nonsense 144 335 2 8
ENSDART00000065091 Nonsense 144 370 2 9

The following transcripts of ENSDARG00000044203 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 39849799)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39921399
GRCz11 6 39918935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAGTCACAAACCAGCAGTTCCAGCACTTCACCAACCAGACCGGTTA[C/A]ATAACGGAGGTAAATAACCCTTTACACGGCTATACGACAAATTATCAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link