zgc:66317

Ensembl ID:
ENSDARG00000044167
ZFIN ID:
ZDB-GENE-031116-67
Description:
protein-arginine deiminase type-2 [Source:RefSeq peptide;Acc:NP_956406]
Human Orthologues:
PADI1, PADI2, PADI3, PADI4
Human Descriptions:
peptidyl arginine deiminase, type I [Source:HGNC Symbol;Acc:18367]
peptidyl arginine deiminase, type II [Source:HGNC Symbol;Acc:18341]
peptidyl arginine deiminase, type III [Source:HGNC Symbol;Acc:18337]
peptidyl arginine deiminase, type IV [Source:HGNC Symbol;Acc:18368]
Mouse Orthologues:
Padi1, Padi2, Padi3, Padi4, Padi6
Mouse Descriptions:
peptidyl arginine deiminase, type I Gene [Source:MGI Symbol;Acc:MGI:1338893]
peptidyl arginine deiminase, type II Gene [Source:MGI Symbol;Acc:MGI:1338892]
peptidyl arginine deiminase, type III Gene [Source:MGI Symbol;Acc:MGI:1338891]
peptidyl arginine deiminase, type IV Gene [Source:MGI Symbol;Acc:MGI:1338898]
peptidyl arginine deiminase, type VI Gene [Source:MGI Symbol;Acc:MGI:2655198]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40787 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38578 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064842 Essential Splice Site 110 647 3 16
ENSDART00000127766 Essential Splice Site 136 701 3 16
ENSDART00000140943 Essential Splice Site 136 299 3 7
Genomic Location (Zv9):
Chromosome 6 (position 47791278)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47851930
GRCz11 6 47850689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAAAACGGAGACGCTTGGGGACGCCATACTGCATCTTACAGCTGTTG[G/A]TATGTGTCTGCTGTGTGTACATTGCACTTAATGTGAGACATACGCCTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064842 Nonsense 172 647 6 16
ENSDART00000127766 Nonsense 198 701 6 16
ENSDART00000140943 Nonsense 198 299 6 7
Genomic Location (Zv9):
Chromosome 6 (position 47795740)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47856392
GRCz11 6 47855151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTGAAGAAGAGCTGAGTAATGTTCTTTTTTTTGTTTTTTGGCAGATT[T/A]GAAGGACATGTCCAAGATGGTGTTGCGCACTAATGGACCATCTCAACTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Basal cell carcinoma : Common variants on 1p36 and 1q42 are associated with cutaneous basal cell carcinoma but not with melanoma or pigmentation traits. (View Study)
  • Pulmonary function (interaction): Genome-wide joint meta-analysis of SNP and SNP-by-smoking interaction identifies novel loci for pulmonary function. (View Study)
  • Rheumatoid arthritis: Genome-wide association study of rheumatoid arthritis in Koreans: population-specific loci as well as overlap with European susceptibility loci. (View Study)
  • Rheumatoid arthritis: The human AIRE gene at chromosome 21q22 is a genetic determinant for the predisposition to rheumatoid arthritis in Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link