
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rab3gap2
- Ensembl ID:
- ENSDARG00000044136
- ZFIN IDs:
- ZDB-GENE-030616-610, ZDB-GENE-030616-610
- Description:
- rab3 GTPase-activating protein non-catalytic subunit [Source:RefSeq peptide;Acc:NP_001004528]
- Human Orthologue:
- RAB3GAP2
- Human Description:
- RAB3 GTPase activating protein subunit 2 (non-catalytic) [Source:HGNC Symbol;Acc:17168]
- Mouse Orthologue:
- Rab3gap2
- Mouse Description:
- RAB3 GTPase activating protein subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1916043]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9042 | Splice Site, Nonsense | Mutation detected in F1 DNA | During 2018 |
sa18323 | Nonsense | Available for shipment | Available now |
sa17477 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9042
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064806 | Nonsense | 178 | 1373 | 7 | 37 |
ENSDART00000105503 | Splice Site | None | 1270 | None | 35 |
ENSDART00000126201 | Nonsense | 178 | 1143 | 7 | 37 |
- Genomic Location (Zv9):
- Chromosome 17 (position 25469672)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 25609591 GRCz11 17 25627982 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTATTTTTTNNATCTATGTGTATGTGTAGAGTGGAGTTCTTCTATTAGCA[C/T]AGTTGTTGCATGAAGATCCTGTGCTGCGCCTGAAATGTCGGACTTATGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18323
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064806 | Nonsense | 1004 | 1373 | 28 | 37 |
ENSDART00000105503 | Nonsense | 942 | 1270 | 25 | 35 |
ENSDART00000126201 | Nonsense | 975 | 1143 | 26 | 37 |
- Genomic Location (Zv9):
- Chromosome 17 (position 25459427)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 25599346 GRCz11 17 25617737 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- NNNNNNNNNNNNNNNNNNNNNNNAATCTMCTGATGTGCTKTTTGCTCACTG[T/A]AGCTGGGAAAATGTGGTGCAGTGGAACAAAGACCCAGAGGTAAAAACTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17477
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064806 | Essential Splice Site | 1324 | 1373 | None | 37 |
ENSDART00000105503 | Essential Splice Site | 1220 | 1270 | None | 35 |
ENSDART00000126201 | Essential Splice Site | None | 1143 | None | 37 |
- Genomic Location (Zv9):
- Chromosome 17 (position 25452954)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 25592873 GRCz11 17 25611264 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTGCTGGCTCGTCTGCCACCCACCCTCTGCACGTGGCTGAAGGCTATGG[T/A]GAGAACACGCACACACTGCACACYTCTCAAMAGATCACATCATTTGCCAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: