
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-103f16.3
- Ensembl ID:
- ENSDARG00000044135
- ZFIN IDs:
- ZDB-GENE-030131-1828, ZDB-GENE-040801-74
- Description:
- Centromere protein P [Source:UniProtKB/Swiss-Prot;Acc:Q1LV50]
- Human Orthologue:
- CENPP
- Human Description:
- centromere protein P [Source:HGNC Symbol;Acc:32933]
- Mouse Orthologue:
- Cenpp
- Mouse Description:
- centromere protein P Gene [Source:MGI Symbol;Acc:MGI:1913586]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37440 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa37440
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064805 | Essential Splice Site | 213 | 282 | 7 | 9 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10621310)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 10481478 GRCz11 22 10511160 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGGATGCAGATCAGAGATCATGATTATACGAAGTCCTCAACTTCCAGGG[T/C]AGGTTCCATCAGCTGAGAAAATCGAATAGAAACTGCAGTTTATTACTTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: