zgc:92903

Ensembl ID:
ENSDARG00000044125
ZFIN ID:
ZDB-GENE-040718-162
Description:
thioredoxin [Source:RefSeq peptide;Acc:NP_001002461]
Human Orthologues:
TXN, TXNDC2, TXNDC8
Human Descriptions:
thioredoxin domain containing 2 (spermatozoa) [Source:HGNC Symbol;Acc:16470]
thioredoxin domain containing 8 (spermatozoa) [Source:HGNC Symbol;Acc:31454]
thioredoxin [Source:HGNC Symbol;Acc:12435]
Mouse Orthologues:
Txn1, Txndc2, Txndc8
Mouse Descriptions:
thioredoxin 1 Gene [Source:MGI Symbol;Acc:MGI:98874]
thioredoxin domain containing 2 (spermatozoa) Gene [Source:MGI Symbol;Acc:MGI:2389312]
thioredoxin domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1914652]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14838 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064789 Essential Splice Site 87 107 4 5

The following transcripts of ENSDARG00000044125 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 25524747)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24086499
GRCz11 7 24357656
KASP Assay ID:
1641-0481.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCATCTCATGCATGCCAACATTCCATTTCTACAAGAATGGAAAGAAG[G/A]TACTGTAAATCACCCTGCCATGGTTTCTTRAGTKAGCTATTATTTGGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link