znf593

Ensembl ID:
ENSDARG00000044102
ZFIN ID:
ZDB-GENE-040426-1789
Description:
zinc finger protein 593 [Source:RefSeq peptide;Acc:NP_957111]
Human Orthologue:
ZNF593
Human Description:
zinc finger protein 593 [Source:HGNC Symbol;Acc:30943]
Mouse Orthologue:
Zfp593
Mouse Description:
zinc finger protein 593 Gene [Source:MGI Symbol;Acc:MGI:1915290]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39163 Nonsense Mutation detected in F1 DNA During 2018
sa36412 Missense, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064754 Nonsense 32 55 3 5
ENSDART00000082237 Nonsense 69 129 4 5
ENSDART00000146309 Nonsense 69 129 3 4
Genomic Location (Zv9):
Chromosome 17 (position 24514277)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24667719
GRCz11 17 24686120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACATGTTTTATATAATATTTTTTTCCACCAAAAACATTTTAGGAGATA[T/A]TTTGTTGACTTGAAAACCTTAAAGGAGCATTTCAAATCCAAACCCCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064754 Missense 54 55 5 5
ENSDART00000082237 Nonsense 91 129 5 5
ENSDART00000146309 Nonsense 91 129 4 4
Genomic Location (Zv9):
Chromosome 17 (position 24514444)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24667886
GRCz11 17 24686287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGATTTTCATCCTATGTGTTGTTTGTGTGTTGTATTGTAGATTAAAG[C/T]AGCTTAGGGAAGAGCCATACACACAGGCTGAAGCTGAGCGAGCAGCAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link