zgc:63505

Ensembl ID:
ENSDARG00000044097
ZFIN ID:
ZDB-GENE-040426-1139
Description:
stomatin-like protein 2 [Source:RefSeq peptide;Acc:NP_957325]
Human Orthologue:
STOML2
Human Description:
stomatin (EPB72)-like 2 [Source:HGNC Symbol;Acc:14559]
Mouse Orthologue:
Stoml2
Mouse Description:
stomatin (Epb7.2)-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913842]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34875 Nonsense Mutation detected in F1 DNA During 2018
sa21704 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064747 Nonsense 80 247 3 7
Genomic Location (Zv9):
Chromosome 10 (position 17283915)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16909261
GRCz11 10 16867245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTTTAGGGTCTAAATTTCTTAATTCCAATCCTGGACAGAATTAGATA[T/A]GTTCAGAGCCTCAAAGAGATCGTTATAGATGTACCAGAGCAGTCAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064747 Nonsense 183 247 6 7
Genomic Location (Zv9):
Chromosome 10 (position 17288667)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16904509
GRCz11 10 16862493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACCAGGCGTCAGATGAATGGGGGATTCGATGTCTACGATATGAGATT[A/T]AAGACATTCACGTTCCTCCACGAGTAAAAGAATCTATGCAAATGCAGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link