zmpste24

Ensembl ID:
ENSDARG00000044090
ZFIN ID:
ZDB-GENE-030131-6312
Description:
CAAX prenyl protease 1 homolog [Source:RefSeq peptide;Acc:NP_956186]
Human Orthologue:
ZMPSTE24
Human Description:
zinc metallopeptidase (STE24 homolog, S. cerevisiae) [Source:HGNC Symbol;Acc:12877]
Mouse Orthologue:
Zmpste24
Mouse Description:
zinc metallopeptidase, STE24 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1890508]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10379 Nonsense Available for shipment Available now
sa9593 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082193 Nonsense 248 468 6 10
ENSDART00000082193 Nonsense 248 468 6 10
Genomic Location (Zv9):
Chromosome 17 (position 24436244)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24589686
GRCz11 17 24608087
KASP Assay ID:
2261-1062.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCGAAAGCATGGCCAAGTCCATCAGCTTMCCTCTCACCAAGCTCTA[T/A]GTAGTAGAAGGTACAGCAAGCCATCTTCTTTTCATTTGTTCGTACATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082193 Nonsense 248 468 6 10
ENSDART00000082193 Nonsense 248 468 6 10
Genomic Location (Zv9):
Chromosome 17 (position 24436244)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24589686
GRCz11 17 24608087
KASP Assay ID:
2261-1062.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCGAAAGCATGGCCAAGTCCATCAGCTTMCCTCTCACCAAGCTCTA[T/A]GTAGTAGAAGGTACAGCAAGCCATCTTCTTTTCATTTGTTCGTACATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link