
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nkx6.2
- Ensembl ID:
- ENSDARG00000044075
- ZFIN IDs:
- ZDB-GENE-070626-1, ZDB-GENE-070626-1
- Description:
- homeobox protein Nkx-6.2 [Source:RefSeq peptide;Acc:NP_001129256]
- Human Orthologue:
- NKX6-2
- Human Description:
- NK6 homeobox 2 [Source:HGNC Symbol;Acc:19321]
- Mouse Orthologue:
- Nkx6-2
- Mouse Description:
- NK6 homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:1352738]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa660 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa660
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127624 | Nonsense | 186 | 278 | 2 | 3 |
ENSDART00000130200 | Nonsense | 159 | 167 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 13 (position 52989230)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 51155980 GRCz11 13 51580732 - KASP Assay ID:
- 554-0568.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCGAGCAGACCAAATATCTGGCCGGTCCGGAGAGAGCCAGACTCGCCTA[T/A]TCTCTGGGAATGACCGAGAGCCAAGTCAAGGTAAACACAAAACTCCCAGA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: