
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-274l13.1
- Ensembl ID:
- ENSDARG00000044015
- ZFIN ID:
- ZDB-GENE-091204-26
- Human Orthologues:
- AC144571.1, GFRA2
- Human Description:
- GDNF family receptor alpha 2 [Source:HGNC Symbol;Acc:4244]
- Mouse Orthologue:
- Gfra2
- Mouse Description:
- glial cell line derived neurotrophic factor family receptor alpha 2 Gene [Source:MGI Symbol;Acc:MGI:
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21711 | Essential Splice Site | Available for shipment | Available now |
sa15984 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21711
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080430 | Essential Splice Site | 123 | 488 | 3 | 9 |
ENSDART00000148013 | None | 119 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 19792114)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 19801542 GRCz11 10 19758923 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAAACAATAATAATAGCTCTTTTATTTCCTCTGTGTTCTGTTCTTTTCA[A/G]GGTGAAGAACTCTATGAGACCTCTCCATATGAACCGATGCATCTTTCTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15984
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080430 | Nonsense | 399 | 488 | 7 | 9 |
ENSDART00000148013 | None | 119 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 19755069)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 19764564 GRCz11 10 19721945 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTCGGCAGTCCCATCAGTACGGAMCAATCTGCAACCGGCTATCATCACC[A/T]AACATGTCATCAACTCAAATGATGTCAAGCAAATAGACAGTGCATGYGTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: