zgc:91876

Ensembl ID:
ENSDARG00000043997
ZFIN IDs:
ZDB-GENE-040704-28, ZDB-GENE-040704-28
Description:
cytochrome P450 like [Source:RefSeq peptide;Acc:NP_001002187]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30750 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13071 Nonsense Available for shipment Available now
sa13766 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064596 Essential Splice Site 112 495 2 9
ENSDART00000104197 Essential Splice Site 108 428 2 9
Genomic Location (Zv9):
Chromosome 25 (position 17751659)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17298500
GRCz11 25 17394900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGTCGACCTCAAGACTTCATGATCAGTCATCTCACAGAGTGTAAAG[G/A]TAATTCCTAAAAAAAGCTGTCTTAGATAGTTAAATGGAAAATCACAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064596 Nonsense 248 495 5 9
ENSDART00000104197 Nonsense 244 428 5 9
Genomic Location (Zv9):
Chromosome 25 (position 17746471)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17293312
GRCz11 25 17389712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTAAAAAAGGATTTGATCATGTGAAGGTATTAAAAGGTATGAATTTG[A/T]AGCTGATTGACGAACACAAGAGCACAAGAKTCCCWGGAAAGCCGAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064596 Essential Splice Site 432 495 9 9
ENSDART00000104197   None 428 None 9
Genomic Location (Zv9):
Chromosome 25 (position 17743797)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17290638
GRCz11 25 17387038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGCTAWATATTTTAWWTTCATTTMTCCTGCATTTACTGTGTTTCTCC[A/T]GGYCCWCGTGTGTGTCTGGGTGAAGGTCTGGCCCGTATGGAGCTCTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link