tube1

Ensembl ID:
ENSDARG00000043982
ZFIN ID:
ZDB-GENE-040426-1174
Description:
tubulin epsilon chain [Source:RefSeq peptide;Acc:NP_957279]
Human Orthologue:
TUBE1
Human Description:
tubulin, epsilon 1 [Source:HGNC Symbol;Acc:20775]
Mouse Orthologue:
Tube1
Mouse Description:
epsilon-tubulin 1 Gene [Source:MGI Symbol;Acc:MGI:1919174]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43359 Nonsense Mutation detected in F1 DNA During 2018
sa43360 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064562   None 271 None 9
ENSDART00000064565   None 271 9 13
ENSDART00000124476 Nonsense 296 471 9 12
ENSDART00000132669 Nonsense 296 470 9 13
Genomic Location (Zv9):
Chromosome 20 (position 292306)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 282901
GRCz11 20 271536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGAATGAGATAGCCATGAACCTGGTCCCTTTCCCACGTTTACACTA[C/A]CTTGTGTCCAGCCTGACTCCTCTCTACACACTGGCTGATGTCAGTGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064562   None 271 None 9
ENSDART00000064565   None 271 12 13
ENSDART00000124476 Nonsense 428 471 12 12
ENSDART00000132669 Nonsense 427 470 12 13
Genomic Location (Zv9):
Chromosome 20 (position 295227)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 285822
GRCz11 20 274457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAATGGTGTTTGTTGTGCCCCTACCCCACAGGCTCATTTGCATCATTA[T/A]CTAGCCGTTGATGGCATGGAGCAGTCTGGATTCACTGAAGCGCTGTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link