
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:busm1-189a20.4
- Ensembl ID:
- ENSDARG00000043973
- ZFIN ID:
- ZDB-GENE-030131-9559
- Description:
- zinc finger protein 292 [Source:RefSeq peptide;Acc:NP_001025383]
- Human Orthologue:
- ZNF292
- Human Description:
- zinc finger protein 292 [Source:HGNC Symbol;Acc:18410]
- Mouse Orthologue:
- Zfp292
- Mouse Description:
- zinc finger protein 292 Gene [Source:MGI Symbol;Acc:MGI:1353423]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23613 | Nonsense | Available for shipment | Available now |
sa23612 | Nonsense | Available for shipment | Available now |
sa12684 | Nonsense | Available for shipment | Available now |
sa1811 | Missense | F2 line generated | During 2018 |
sa18668 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23613
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104790 | Nonsense | 124 | 2620 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 228063)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 218658 GRCz11 20 207293 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGCAGAGCTGCTGCTTTCTCTGCCGCGGAATATCCCAGATGCATTGTG[G/A]GACAGGTTTAGGACATCCGTCCAGGTACATTTAGCAGGCTGTCTCTATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23612
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104790 | Nonsense | 333 | 2620 | 7 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 225037)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 215632 GRCz11 20 204267 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCAGATGTCGTTCCTGTCTAAAACTGTGTTCCACCTACTCTTCTTCATT[A/T]AATTCATCCAAACAGAGGTGAGCTGTGCCTGTTCACACTTACAGCTGTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12684
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104790 | Nonsense | 1030 | 2620 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 222594)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 213189 GRCz11 20 201824 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTCGTCTCACTGGGTCAGATGCTTCCYCCCGTTTCTCAGACACTTCCTT[T/A]GCAAATGGCTTCCGTACCAAACGAKGGACAAGTTTTGGAAAACAAATGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1811
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104790 | Missense | 2209 | 2620 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 219058)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 209653 GRCz11 20 198288 - KASP Assay ID:
- 554-1803.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTCTGGAAGTACATCCGCCACGTTGACAAAAAGCATAAAGAAACCCAG[C/T]TCTCAAAGGTTAACGCTGTGGCGGGGGTGTTCAGATGTCCGATGGAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18668
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104790 | Nonsense | 2349 | 2620 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 218636)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 209231 GRCz11 20 197866 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGGGTTGTGAAACGGTGACGAGTTCAGAGMGAAATATAATGAAGCATTA[T/A]CTWCAGCATGGCCTCCCAAAACARYAYTYGRAAGAACAGAGAAGCAACTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Total ventricular volume: Genome-wide association with MRI atrophy measures as a quantitative trait locus for Alzheimer's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: