zgc:110283

Ensembl ID:
ENSDARG00000043936
ZFIN ID:
ZDB-GENE-050417-72
Description:
hypothetical protein LOC550268 [Source:RefSeq peptide;Acc:NP_001017605]
Human Orthologue:
ANXA1
Human Description:
annexin A1 [Source:HGNC Symbol;Acc:533]
Mouse Orthologue:
Anxa1
Mouse Description:
annexin A1 Gene [Source:MGI Symbol;Acc:MGI:96819]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38522 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064512 Nonsense 242 340 10 13
ENSDART00000073926 Nonsense 185 283 8 11
ENSDART00000131368   None 35 None 4
ENSDART00000133044   None 198 None 8
ENSDART00000144620   None 198 None 8
Genomic Location (Zv9):
Chromosome 5 (position 67505758)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64322723
GRCz11 5 64996496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAAATCCACAGTTTTCCAATATTATGGTCAATTTAGTAAAGATGGTT[T/A]GGCCAAAGATCTGCAGAGCGAGCTAAGTGGAGACTTTGAAGACTGCATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link