
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rnf14
- Ensembl ID:
- ENSDARG00000043905
- ZFIN ID:
- ZDB-GENE-040625-65
- Description:
- ring finger protein 14 [Source:RefSeq peptide;Acc:NP_001002087]
- Human Orthologue:
- RNF14
- Human Description:
- ring finger protein 14 [Source:HGNC Symbol;Acc:10058]
- Mouse Orthologue:
- Rnf14
- Mouse Description:
- ring finger protein 14 Gene [Source:MGI Symbol;Acc:MGI:1929668]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17780 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17780
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010942 | Essential Splice Site | 51 | 459 | 2 | 8 |
ENSDART00000139343 | Essential Splice Site | 51 | 240 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 21 (position 40533819)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 41831438 GRCz11 21 41844648 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTCATCTGTGCYTAGAGCTTCCACCTAACTTCAAGCTGCTAGTCAAGGG[T/C]GAGACAGWAGCMATGTTTCCATYCAAAAATGCGAATGAAMTTTATGSGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: