ugt5g2

Ensembl ID:
ENSDARG00000043901
ZFIN ID:
ZDB-GENE-081028-66
Description:
UDP glucuronosyltransferase 5 family polypeptide g2 [Source:UniProtKB/TrEMBL;Acc:D3XDB4]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41649 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34899 Nonsense Mutation detected in F1 DNA During 2018
sa34898 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064471 Essential Splice Site 42 534 2 2
Genomic Location (Zv9):
Chromosome 10 (position 22285410)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22115748
GRCz11 10 22085200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAGAAAACATACTTGGATTTAAAGCCTATGTGCACTCTGTTGCCCCCT[A/G]GGTGCTGGTGAAGAAGCTGCAGTCTCGTGGACACGAGCTGAGTGTGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064471 Nonsense 63 534 2 2
Genomic Location (Zv9):
Chromosome 10 (position 22285343)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22115681
GRCz11 10 22085133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGTCTCGTGGACACGAGCTGAGTGTGATTCGCCTGGAGGACAGCTG[G/A]TTCATCAAGGGCAATTCACCTTACTACTCCTCTATTACAGTGACGCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064471 Nonsense 356 534 2 2
Genomic Location (Zv9):
Chromosome 10 (position 22284466)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22114804
GRCz11 10 22084256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTATTGGACAGAGACCTTCAACGTTGGGCAATAACACCCTACTTATT[C/T]AATGGCTTCCTCAGAATGACTTGCTGGGCCATCCGAAGACTCGTGCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link