amd1

Ensembl ID:
ENSDARG00000043856
ZFIN ID:
ZDB-GENE-040426-760
Description:
S-adenosylmethionine decarboxylase proenzyme [Source:RefSeq peptide;Acc:NP_001155073]
Human Orthologue:
AMD1
Human Description:
adenosylmethionine decarboxylase 1 [Source:HGNC Symbol;Acc:457]
Mouse Orthologues:
Amd-ps3, Amd1, Amd2
Mouse Descriptions:
S-adenosylmethionine decarboxylase 1 Gene [Source:MGI Symbol;Acc:MGI:88004]
S-adenosylmethionine decarboxylase 2 Gene [Source:MGI Symbol;Acc:MGI:1333111]
S-adenosylmethionine decarboxylase, pseudogene 3 Pseudogene [Source:MGI Symbol;Acc:MGI:3704487]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36945 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064391 Essential Splice Site 109 334 4 10
ENSDART00000135919 Essential Splice Site 109 334 4 9
Genomic Location (Zv9):
Chromosome 20 (position 3001101)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2954963
GRCz11 20 2967803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGTTGCTGGTTTCTGAAAATGTGACTTGATCATCCTTATTTTCTTTC[A/T]GAATTTCTTCTATTCTCGCAAAAATTTTATGAAGCCCACCCATCAAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link