
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rab3ab
- Ensembl ID:
- ENSDARG00000043835
- ZFIN ID:
- ZDB-GENE-041210-268
- Description:
- ras-related protein Rab-3A [Source:RefSeq peptide;Acc:NP_001017761]
- Human Orthologue:
- RAB3A
- Human Description:
- RAB3A, member RAS oncogene family [Source:HGNC Symbol;Acc:9777]
- Mouse Orthologue:
- Rab3a
- Mouse Description:
- RAB3A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:97843]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10193 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10193
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104289 | Nonsense | 11 | 220 | 2 | 5 |
ENSDART00000124350 | Nonsense | 78 | 287 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 11 (position 6916737)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 6824231 GRCz11 11 6834070 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTCCCCTTAATCTTCCAGATGGCTTCAGCTACAGACAACCGTTATGGA[C/T]AAAAGRAGTCTTCTGACCAGAACTTTGATTACATGTTCAAAATCCTAATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: