zgc:113209

Ensembl ID:
ENSDARG00000043808
ZFIN IDs:
ZDB-GENE-050410-8, ZDB-GENE-050410-8
Description:
hypothetical protein LOC548342 [Source:RefSeq peptide;Acc:NP_001017546]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1458 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064326 Nonsense 502 528 3 3
ENSDART00000123644 Nonsense 502 528 2 2
Genomic Location (Zv9):
Chromosome 4 (position 61932133)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 74841102
GRCz11 4 76422165
KASP Assay ID:
554-1383.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGAGAGAAGCCKTTCACCTGCTTGGAGTGTGGGAAGTGTTTTTCTTG[T/A]AGCAAGGGCCTGAAGTTTCATTTACAAAGTCATTTTGGAATAAACCTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link