si:rp71-7l19.2

Ensembl ID:
ENSDARG00000043792
ZFIN ID:
ZDB-GENE-081103-31
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B0S5W9]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18303 Nonsense Available for shipment Available now
sa20299 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064309   None 126 None 3
ENSDART00000139539 Nonsense 348 745 3 4
Genomic Location (Zv9):
Chromosome 4 (position 29357748)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 30098216
GRCz11 4 30052740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAAAAGGAGGAGTACTTCAGAAAGAGACTCACAGACCCGAATCAGGCC[A/T]GAGAAATCATTGATCACATTAAACAGTCAAATAGTCTCTTTATTATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064309   None 126 None 3
ENSDART00000139539 Nonsense 684 745 3 4
Genomic Location (Zv9):
Chromosome 4 (position 29356740)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 30097208
GRCz11 4 30051732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATCAGACGAGTGTCTCATTAGACTATCAGCAGTCATCAAAACCTCC[A/T]AAAGAGCTCAGTAAGTCTAAGTCATTCTTTCTTTCATCTAAGCTATAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link